Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16163-NR
Clone ID PST16163-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST16163-NR
Sequence
GAATGGCTAGTCAGGGTGGCATGGCCGCTGTGTGGTGCAGAAGGCGTCTGAGACAGGTAGACTTGGAGACACCAGATGTG
TGACCCTGACCAAGACATTTGACTTAACTTAGTCTTTATCCTGTGTAAAATTACCTCAATGGGGTTGATGTCTTAAAGGG
AAGGCACAGTTGAGTCTTGCCACNAACAACAGTGAGTTCCTATCCATTCAGGGGAAAACTACNCCCTCCCTAATTTGGCC
CTCCCCCCCCCCCCCACCCCCCACCCGCCAAGGAAAGTCACGCACCGCCCCCTGGGGGTTGGTTAACATTTAGAAAGAAA
CGCCATTGGTTTCATTGCGGAAAAAAAACGGANAAAACGAAACGGTTGGGGGGGAACACAGTGGTGGGGCCTAATNCGGG
CTTGAACNAAAGGGTCACCAGNAAGTNCTAAG
Sequence Type genomic DNA
Unitrap ID UNI37522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77634341..77634548 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005410 (Mcm5) NM_008566 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:103197]

 
Come back to gene ENSMUSG00000005410


For any suggestions or comments, please send an email to unitrap@crg.es