Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16156-NR
Clone ID PST16156-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST16156-NR
Sequence
GCACAACTACCCGGAATTTTTATTTATTATTATCTTTTTTTGTGTTATATTTTATTTTTGAGACAGGGTCTCATATGTTC
CCAGGGATGGTCTTGACCTTACTTTGTAGCTGAGGGTAACCCTGACTCCATCTATCAAGGTACTGTGATGTGATGAGAGC
CT
Sequence Type genomic DNA
Unitrap ID UNI37523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125065419..125065573 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063870 (Chd4) NM_145979 chromodomain helicase DNA binding protein 4 Gene [Source:MGI (curated);Acc:Chd4-002]

 
Come back to gene ENSMUSG00000063870


For any suggestions or comments, please send an email to unitrap@crg.es