Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16978-NL
Clone ID PST16978-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST16978-NL
Sequence
GGGGCAAGCTGGGAGCCTGGAGGACTAGGCGAGGAGTAGTTGAGAGAACGGAGCGGAACGCCATGGCGGCCGACATCGAG
CAGGGTTTTCAGGTCTTTTCGTGGTCAGTAAATTCCGGGAAAATACAACAGGAGCTTTCCAGGTAAACGCTTCCCAGACT
TTTCTGCTCCTCGCGGGCTGTTAGGGCTTCATCTAGCCTCCCGTGGCATCTTTCACGG
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648095..91648305 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es