Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16767-NR
Clone ID PST16767-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST16767-NR
Sequence
TTACGACCCTTTTAAGATGGTTCCCCTTTTGACCACCAGCTGTGAAATTACTATTTGTTTTTTCAAGATAGGGTTTCTCT
GAATAGCCCTGACTGTCCTGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTTAGAAATCTGCCTGCCTCGGCCTCCCG
AGTGCTGGGATTAAAGGCATG
Sequence Type genomic DNA
Unitrap ID UNI18350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44216324..44216503 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009927 (Rps25) NM_024266 ribosomal protein S25 Gene [Source:MGI Symbol;Acc:MGI:1922867]

 
Come back to gene ENSMUSG00000009927


For any suggestions or comments, please send an email to unitrap@crg.es