Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16716-NR
Clone ID PST16716-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST16716-NR
Sequence
TTTGTACTCAGCGAATGTACAAATGAAGAGAAAGCGTGCTTTTGGCTACTGGGAAGCCAGAGGTTTAGAGCCTTGCTCAT
TAAAGTTGGAGAATAAGATAGATTTCTCTTGTGGAAGGGACAGTA
Sequence Type genomic DNA
Unitrap ID UNI37504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24193861..24193985 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024812 (Tjp2) NM_011597 tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

 
Come back to gene ENSMUSG00000024812


For any suggestions or comments, please send an email to unitrap@crg.es