Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16212-NL
Clone ID PST16212-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST16212-NL
Sequence
TGTCTTGATCCTACCCCCAGGATCAGCGAAGTGGAGCCCAAATACTATGCAGATGGGGAAGATGCGTATGCAATGAAGCG
GGACCTCACGCAGATGGCTGATGAGGTAAGAGTTCAGCCAGTCCAGGGCAGCAATTCCAGCAGCAGGGGAGATTCTGTAC
TTGGGAAAGGTGGCTACTTTAGAGCTGTGAGACTGAGTGAGGCAGTGGTGGCTAGAGGCAAGACCAAGATT
Sequence Type genomic DNA
Unitrap ID UNI37527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71163056..71163286 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031388 (Ard1) NM_019870 ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ard1-004]

 
Come back to gene ENSMUSG00000031388


For any suggestions or comments, please send an email to unitrap@crg.es