Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-W139
Clone ID Ayu21-W139
Vector 21-W139GenetrapVector
Project egtc

Sequence tag Ayu21-W139
Sequence
TGGTCGTGGTGTCGTGTCCTTTGCCACCGCGCTTCAGCGCCACCAAGGAGCGTGCCGTGGACGGACCAGACCGGACCGAG
CGCTTGCNTAGGTTGGCCTGGGCCCAGTGCCGATCGCGCGGAGCCGAGCAACTTCGGTTGGCCAGCACATTGAGCCAGCA
CATCCACATAAGTTGCCTTTTGACAGAACTGTGGCCATGGCAGCATGGTAGGATCCGTGTCCCGGACCCTGAGGCCAGAA
TGAGTGAAGAAGCATGCCGAACCCGCAGTCAGAAGCGCACCCTTGAACCTGACCTAACGGAGGATGATGTGGAGAACAAG
AAAATGAAAATGGAGAAAGGGTCATCAGAGCTGACAGTGGACGGAGACAGCAGGGTGATGCCAGAGCCGAGTGCAGGCTC
AGCCCAGGGGTTGCTGAGGACAACAGAGGCCATGGGCACAGGATCTGGCGAGGGGCTGTTAGGAGACGGGCCTGTGGACA
TGCGCACTTCACACAG
Sequence Type mRNA
Unitrap ID UNI3517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72459678..72519931 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es