Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-W94
Clone ID Ayu21-W94
Vector 21-W94GenetrapVector
Project egtc

Sequence tag Ayu21-W94
Sequence
GTGTGTTCTCATGCGAACGGGAAGGAGCGTTGGGGATCTGGAGTCTCGAGGTTGAGACATTTTCGGGCCCGAAAAAGGAA
GGATCGGCTGCCGTCGCTGCCAAGTCCGCGCCCGCTCTTCTTTGCTGTCTCCGGCCCGGCCCGGCCGTGCCGCCTTTTCT
TGCCGTCTCCCTCCTCGGCCGTCCCCGCGTGTTTTGCGCGGTCGCCGGGCACCGGGGCTGCGGCGACGAGCCCGCGGGCG
GCCGGTCGGGCGGGGCGGGCGGCTGACAGCGTCCTGAGGTTAGCATTATACTTTTCCAGTGGAGCCCATGACTTCTGATC
AGGACGCTAAAGTTGTGGCTGAACCGCAGGCACAGCGAGTCCAGGAGGGCAAGGACAGCTCTCATACTGATGAATGGTCC
TATATCGCAAACCACTTCTCAAACAAGGTCCCTCCCAGACTTTGANTCAG
Sequence Type mRNA
Unitrap ID UNI2568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9093158..9123208 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es