Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-W74
Clone ID Ayu21-W74
Vector 21-W74GenetrapVector
Project egtc

Sequence tag Ayu21-W74
Sequence
GCCCAGCGGCCATGACCGCCGAGGAGATGAAGGCGGCGGAGAACGGGGCGCAGTCGGCGCCCCTGCCTCTCGAAGGAGTG
GACATCAGCCCCAAACAGGACGAGGGCGTGCTCAAGGTCATCAAGAGAGAGGGTACAGGCACAGAGACACCCATGATCGG
GGACCGAGTCTTTGTCCACTACACTGGCTGGCTGCTAGATGGCACAAAGTTTGACTCCAGTNTGGACCGCAAGGACAAAT
TNTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGATATTGCTGTGGCAACCATGAAAGTGGGGGAAGTGTGC
CACATCACCTGCAAGCCAGAATATGCCTATGGCGCAGCAGGCAGCCCTCCGAAGATCCCCCCCAACGCCACACTTGTATT
TGAGGTGGAGCTGTTTGAGTTCAAAGGAGAAGATCTTACAGAAGAAGAAGATGGCGGGATCATCCGCAGAATACGGACTC
GGGGTGAAGGCTATGCCAGGCCCAATGATGGTGCTATGGTGGAAGTGGCCCTGGAAGGCTACCACAAGGACCGCCTCTTT
GACCAGCGGGAGCTCTGCTTTGAAGTCGGGGAAGGGGAAAGTCTAGATCTGCCCTGTGGGCTGGAGGAGGCCATTCAGCG
CATGGAGAAAGGAGAGCATTCCATCGTGTACCTCAAACCTAG
Sequence Type mRNA
Unitrap ID UNI37532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128384323..128388539 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030357 (Fkbp4) NM_010219 FK506 binding protein 4 Gene [Source:MGI (curated);Acc:Fkbp4-001]

 
Come back to gene ENSMUSG00000030357


For any suggestions or comments, please send an email to unitrap@crg.es