Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST416502
Clone ID OST416502
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST416502
Sequence
CGCTGCAAGGGAAAGACCATTTGCTGTTTTTCCTGGCTCTGAAGTGGAAGATGTCTGCAGACAGTCAAAGCATCGCGGCT
ACTGAGAACGAGGAGAAATCCCATGAGGTCACTGGTAGGCTCGAAGGAGATAATGAGTGTGTGAGTCGTCTGTAAGCAGT
TTGTGAGCCTGTAACTGATGACTCCTGTGGTCCATGAAGCGAGAACACCCAGAACTACCAGACCAAGTCAGCGGGACTGG
GATCCTCCCACCTAGTTCTGTTGGTGTTATAACTATTAATAAATAT
Sequence Type mRNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23721727..23722508 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es