Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST416499
Clone ID OST416499
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST416499
Sequence
TGGCAAATGCTCTGGGCACGCTAGTAGAAGATGACANCTGCNTTCNGAATCATGAAAAGGCCCACAGGAGAGAGGCAGTG
ACTCCACTCTCAGCGTACCCTGGAGATGAGTCTGTTGCTTCCCATTTCGCACTGGTCACTGCTTATGAAGACATCAAAAA
GAGGCTGAAGGATTCAGAGAAAGAAAACTCCTTCTTAAAGAAAAGAATCAGGGCTTTGGAAGAAAGGNTGGGTCCCCTCT
CATTTGACTTAAAAANTAATTCCAAATATNGAAAATTTTTAAAAAATTTCTAAACAGTCTTCCAAGAATAA
Sequence Type mRNA
Unitrap ID UNI18714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 117956532..117956835 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039285 (Azi2) NM_013727 5-azacytidine induced gene 2 Gene [Source:MGI Symbol;Acc:MGI:1351332]

 
Come back to gene ENSMUSG00000039285


For any suggestions or comments, please send an email to unitrap@crg.es