Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11517G2HMF2
Clone ID IST11517G2HMF2
Vector
Project tigm

Sequence tag IST11517G2HMF2
Sequence
TGATTGACTACCCGTCAGCGGGGTCTTTCAGAATAAATTTATGTGCTGCCAAGCCTTATGACCTAATGCTGCTAGTTAAC
G
Sequence Type genomic DNA
Unitrap ID UNI6642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90230959..90231008 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es