Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST416342
Clone ID OST416342
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST416342
Sequence
TGAGCTCTCCACCATGCCCGGGGGCGTACCCTGGTCCGCCTACTTGAAAATGCTTTCCTCCAGCCTCCTGGCCATGTGCG
CCGGGGCCCAGGTGGTGCATTGGTACTATCGGCCTGACCTGACAATACCTGAAATCCCACCAAAGCCTGGAGAACTCAAA
ACGGAGCTTTTGGGACTGAAAGAGAGACGCCATGAACCTCATGGTTTTCCACCAGGGG
Sequence Type mRNA
Unitrap ID UNI13823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 82082870..82085571 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063320 (1190007I07Rik) NP_001129039 RIKEN cDNA 1190007I07 gene Gene [Source:MGI Symbol;Acc:MGI:3698433]

 
Come back to gene ENSMUSG00000063320


For any suggestions or comments, please send an email to unitrap@crg.es