Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST415700
Clone ID OST415700
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST415700
Sequence
GACTGAGCAAGATGAGTATCATATGGTTCATCTAGTCTGTGCTTCTCGGAGTCCTCCCAGTTCTCCAAAATCCAGCACCG
ATAGAGGAAGTCACGAAGCACTGGCATCCAGCACCAGCTCTGTGAGTGATCTTGACGGGAGGAAACATTGAACTTTCCTG
ATTCTCTTTCTGCTCTGAAAACGTAAATAGAGGGCCTGGGGTACAGTTCCACAGCACAGCACTTGCCTAACATATGTGAG
GCTGTGTGTTCAGTCCTTACACC
Sequence Type mRNA
Unitrap ID UNI10193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 24934842..24935098 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008429 (Herpud2) NM_020586 HERPUD family member 2 Gene [Source:MGI Symbol;Acc:MGI:1915393]

 
Come back to gene ENSMUSG00000008429


For any suggestions or comments, please send an email to unitrap@crg.es