Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST414777
Clone ID OST414777
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST414777
Sequence
TAGAGAGTGTAGAGAGCANAGAGAGCAGAGANAANGAAGGAATTCCTNNTGATCAGCAGAGGCATGATCTTTGCTGGTAA
GCAGCTGGAAGATGGCCGGACTTTGTCTGACTACAACATTCAAAAGGAGTCCACCCTTCATCTGGTGTTGAGACTTCGGG
GTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAACAAGCATAAGAGGAAGAAGGTTAAGTTGGCT
GAGCTGAAATACTATAAGGTGGATGAAAATGGCAAAATTAGCCGACTTCGTCGAGAGTGTCCTTCTGATGAATGTGGTGC
TGGAGNTTTCATGGNAAGCCACTTTGACAGGCATTACTGNGGCAAGTGTTGNCTGACTNACTGNTTCAACAAACCAGAAG
ACA
Sequence Type mRNA
Unitrap ID UNI18764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29445885..29446790 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020460 (Rps27a) NM_001033865 ribosomal protein S27a Gene [Source:MGI (curated);Acc:Rps27a-003]

 
Come back to gene ENSMUSG00000020460


For any suggestions or comments, please send an email to unitrap@crg.es