Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST414690
Clone ID OST414690
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST414690
Sequence
TGAGGAACTCTACATTGTTGACTCCTAGAATAAATTTGTTCAACATTGTAAAGGCCTGCCTCCCACTCCTCCACCAACCC
CACCACAAATCGATTTGCTACCCTTTGGATGCCATTCATCTGTAATTCCTGGCTGAGCTTTCTGTGACATGTTTGCTGGT
TTATCAAGAGCAGTCCTAAAGAGGGGACTAAAGTGACACNGGAACTGTGATATACTTGCCAAGAGGTACAGGAACAGGCC
TTCCTAGAAGTGGATCCACACCTACACTACTGTGTAGGCTGACACCTGGATGGATGGTATATGAATGCTATGAATCAGAG
TCACCTAGCTAGGCCAATCCCAGAACCCCGACCGTCTAAAACCACAGATGTTTGTTTTGTCTTGAGACTGTGTAACTCAA
TTTGTGAATTGGTGCTTAGTTCCCTTGCCCCTTGAGCCTCACACAGGCTCGAACTTAATGCATGCAGCAGCATGCCTGAT
ATACTCATTAAGCTTTGTGCTAATTTG
Sequence Type mRNA
Unitrap ID UNI18768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7723616..7725055 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]

 
Come back to gene ENSMUSG00000055188


For any suggestions or comments, please send an email to unitrap@crg.es