Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST414479
Clone ID OST414479
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST414479
Sequence
TTTTGAGAACTTGCTGAAGTGTTTCTGAGGGGCCAGCGATGCCAGGATTTGGGACACATTTGAACCTTTAAGCTGTCTGA
CATTGACCTCCTTTCATTATTAATAAAGAAGAAGCAGGGGCTTAGGATGTATTAACACCAGCGCATTACTATACTAACCG
GACAGTGCTCTGCAAAGCCCTCTGCACTCTAAAGGACTGGACTGGCCCAGGACACAATAATTTCCCATTTTCTCAGCTTA
TAATATGACTGGATGGAGGGAAATTTGATAAGCATGAGGGAAGACCATTCCTTTCATGTCCGCTACAGGTAAGACTGCCG
CTCGCTTAGTGCATGGCTGTTCATCTGTTTAGATGTGCATTTAATTCTTGTCCAGTTCAGTTTTTAATTTCAAAGTTCTC
AAAATATACCAATTAAATTTAGTCTGTTCTGCAAGCAGAGTTTTGTGGTAGTGGAAAGTTGTGTATCTTTTGTGGGAAGA
TGGCAGTAGAGACTGTACTGTAATTTATGGGC
Sequence Type mRNA
Unitrap ID UNI18780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108513995..108514493 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027883 (Gpsm2) NP_083798 G-protein signalling modulator 2 (AGS3-like, C. elegans) Gene [Source:MGI (curated);Acc:Gpsm2-001]

 
Come back to gene ENSMUSG00000027883


For any suggestions or comments, please send an email to unitrap@crg.es