Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST414270
Clone ID OST414270
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST414270
Sequence
TGAGCTACTCAGGGACGCAGCTCACTAGGAATCTACAGATTAAGCCGTGGGAACTCGGTGAACACGGGACCATGTGCTTT
AGATCCTACAGGATGGCTCTCTCCTGTTTGAGCAGAGTAAAAACTTACAGGACCCCTTGGAAGAGATTGTACAGTACTTC
ACAAACAACAGTTGACAGCAGGGAGGTCAAAAACTTCCAGGCCCTGGCTCACACGTGGTGGGATGAGTACGGAAAGTTTG
CGCCTCTTCATTCTATGAATGACCTACGGGTGCCATTCATTAGAGACAATCTTTTGAAAACAAGTGCTAGTCACCATCCA
GGAAAGCCTTTATCTGGGATGAAGATTCTTGACGTTGGCTGTGGCGGTGGGTTATTAACTGAACCTCTAGGGAGACTGGG
AGCTTCAGTTGTTGGAATTGATCCCGTGGCTGAAAACATTAAGATAGCACAGCACCATAAGTCCTTTGATCCAGTCCTGG
ATAAGAGGATACAGTACAAAGTGTGTTCCCTGGAGGAGGCCGTGGATGAGAGCGCAGA
Sequence Type mRNA
Unitrap ID UNI18792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21819958..21827565 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028247 (Coq3) NM_172687 coenzyme Q3 homolog, methyltransferase (yeast) Gene [Source:MGI (curated);Acc:Coq3-001]

 
Come back to gene ENSMUSG00000028247


For any suggestions or comments, please send an email to unitrap@crg.es