Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413739
Clone ID OST413739
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413739
Sequence
CTGAGGTCTCTTTGGCTCTTCAGGGNTGCGGGGNCCCATGATGGACTTCTGGTTAACCAAACGGAGCTGTTTGTGCCATC
CCTCAATGTCGATGGACAGCCTATTTTTGCCAACATCACATTGCCAGTGTATACCCTGAAAGAGCGGTGCCTTCAGGTTG
TGCGGAGCCTGGTCAAGCCTGAGAACTACAGGAGACTGGACATCGTCAGGTCACTCTATGAGGATTTGGAGGACTACCCA
AGTGTGCGGAAGGACATACAGCGACTGAGCCAAGAGCACCTTGAGAGTCAGCACCTGGAAGAGGAGCCTTGAAGGAGTCC
ATGGAGATTAAGTGTTCCTGAGTTTCAGCCTTGATGGTCCGAGATTGATCTACACATAGGACAGGTCACTTTCTTTCAGT
TTTAAAATGGTTCATTCTTGGAGTAAAACTATCCATCACGTAAAAGAAAGTTAACTAACATCCCTGGGCTTTGTAGTGTT
TAAGAATAAACATGCAAAGTGCCATTGAT
Sequence Type mRNA
Unitrap ID UNI18813

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113578084..113579758 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033933 (Vhlh) NM_009507 von Hippel-Lindau syndrome Gene [Source:MGI (curated);Acc:Vhlh-001]

 
Come back to gene ENSMUSG00000033933


For any suggestions or comments, please send an email to unitrap@crg.es