Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413619
Clone ID OST413619
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413619
Sequence
GATTGAGTCGACCCCCGTACCAATGGAAGANCCTGCAGCAGCCGNNCTGGCCCATGAGGACTGCCCTGCCATCGACCAGC
CAGCCATGTCTCCAGAAGACAAGAGCCCAATCACTCCCGGAAGCCGGGGTCGCATACAGCCGGGACCGAGCTTGCTTCCT
TGTCACAGACTATGCCCCTTCCCCTGATGGCTCCATCCGAAAAGCCACNTGGTGCTCCCCCACTGCCCCCCCCATGCTGG
CATAAGCCAGGCCCCCCAAGCTTCTTGCCCGACCTCAACGCCAACGCAGCAGCCTGGATATCCCCCTAGNGGACGAGCCC
CTTCCCCCCCAGGCTTTTGTNACCGNNTGAGACCTAGCGAGACCCTCGGGTTNCCCCTGTNCCTTCCCCCCANGTTACGA
GAAGCCCCGCANCCTGAGCAGNATTGAGGGCCTGAGCGGGGNGTNCCTGCNCCTNGCGCCCCTCGCCACCCCCNCTGGNT
CTCCCCGGGCCACGCGCCGAGCTCCCCCGACCCTGCCCTCCATCCTNTAGCGCAGCCCTCCCCCCTGGGGGGGC
Sequence Type mRNA
Unitrap ID UNI18821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51853749..51857398 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062785 (Kcnc3) NM_008422 potassium voltage gated channel, Shaw-related subfamily, member 3 Gene [Source:MGI (curated);Acc:Kcnc3-001]

 
Come back to gene ENSMUSG00000062785


For any suggestions or comments, please send an email to unitrap@crg.es