Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413567
Clone ID OST413567
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413567
Sequence
ACTGAGGGCTCTGTGCCTTTCTGGTCAGTGCCACCTCTGGTACCACCGTGCTAGGGGCCTTTGACCCCCTGGATGCAATT
GCCGATGTTTGCCAGCGACACGGACTGTGGTTCCATGTGGATGGCTGACTCTGTGGCCTGGAACCCTCACAAGCGTTCTC
GCCGCAGGGCTGCAGTGCGTCCGCTCTTCTTCTCCGGGACACCTCGAACCTGCTCAAGCGCTGCCATGGATCCCAGGCCA
GCTACCTCTTCCAGCAAGACAAGTTCTACTGATGTGGCTCTGGACACCGGAGACAAAGTGGTGCAGTGTGGCCGCCGCGT
GGACTGTCTGAAGCTATGGCTCATGTGGAAGGCACAGGGTGGGCAGGGGTTGGAGCGGCGCATCGACCAGGCCTTTGCTN
TCACCCGNTNCTTGTTGGACAAGATT
Sequence Type mRNA
Unitrap ID UNI3211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102009392..102010520 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023044 (Csad) NM_144942 cysteine sulfinic acid decarboxylase Gene [Source:MGI Symbol;Acc:MGI:2180098]

 
Come back to gene ENSMUSG00000023044


For any suggestions or comments, please send an email to unitrap@crg.es