Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413218
Clone ID OST413218
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413218
Sequence
GAAGGTCTCTACAGAGGGCCACCTGTATAACGGCTTTAACATCATAGCAGCTGACCTGAGCACNGTCAAAAGGAGATGTT
GTTTGCTACTATGGAAACCGGGGGGAGCCTGAGCCTATTGTCTTGACACCAGGAACCTATGGGCTAAGCAATGCCCTGCT
GGAGACGCCCTGGAAGAAGCTGTGCTTTGGCAAACAAACTCTTCATGGAAGCAGNGGAGCATAGCGAANCACTCCCTAAA
GACGTG
Sequence Type mRNA
Unitrap ID UNI18839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18303818..18311021 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013539 (D16H22S680E) NM_138583 Ser/Thr-rich protein T10 in DGCR region [Source:UniProtKB/Swiss-Prot;Acc:P54797]

 
Come back to gene ENSMUSG00000013539


For any suggestions or comments, please send an email to unitrap@crg.es