Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413186
Clone ID OST413186
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413186
Sequence
GAGACTGACAGTTTAACACTTGGCCAAGGCCATATACCTGGGCTTACACATTGTTGGCATGCAGCATAGAGATTCTTCAA
AGAAAGAATATTTAAGGACTTAGAAGAAAATATGAAGACATTGACTTAATACAAAGAATTTTAATAGCCAGATACTAAGA
ATAAACTCGGGGATGAACAGCTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38717317..38728154 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es