Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413165
Clone ID OST413165
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413165
Sequence
TGAGTGTTCTCGCCCCCCAGCAGTCAAGATTCTGGCTTGGTCTCCCTCTCCAGCAGCTCTCCGATGAGCAACGAGAGCTC
GAAGGGAGTTCTGGAATGTGAGTCTGCGTCCTCGGAACCTAGCAGCTACGCCGTCAACCAGGTCCTGGAAGAGGATGAGG
ACGAGTGAGCCGCCGCCGGGGCTACTCTGGTCACAGGGTGTTAGGCCGGCTTGTTTTGTTATCGGCAGGGTTTGTTGTTA
TTTGAATTGGCAGTGCTGGCTGCCCATTCAGAAGTTTGGTTCATGTTAGAGTTAGGTTAAAACACTTGTAACAGTGTAGG
ATCCCAGACTACCATCTGCAAGAAGTAAGTGCCTGGCTCACCAAGTTTAAACAGTAATGAGACTCGCTCCCTTGCCCAGA
GCCTGTCCCTTTCCCTTCCTTCTCCACTGTGTTGGTTTTTTTTTTTCG
Sequence Type mRNA
Unitrap ID UNI18842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25677675..25678117 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024837 (Dmrt1) NM_015826 doublesex and mab-3 related transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1354733]

 
Come back to gene ENSMUSG00000024837


For any suggestions or comments, please send an email to unitrap@crg.es