Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0074
Clone ID BC0074
Vector pGT2lxr
Project sanger

Sequence tag BC0074
Sequence
TTTTTAAGGGGGTTTTTTTTTTTTTCCGTAGTTCCAGCACTTCTGCTCTTGCTTTTTGTTTTGTTTTCTGCGTAAACCTC
TGGCCCACTCTCAAAAGGCAAGATGTCCAGTCATGTCCCGGCGGATATGTTGCCTGACTCCCCGTCGTGTAGATAACTAC
GATACGGGAGGGCTTACCATGGGGCACCCAGAGCACCATTTGGTTCAGAGTTGTTAAGGGTTTTTTTTTTTTTTTCCGTA
GTTCCAGCACTTCTGCTCTTGCTTTTTGTTTTGTTTTCTGCGTAAACCTCTGGCCCACTCTCAAAAGGCAAGATGTCCAG
TCATGTCCCGGCGGATATG
Sequence Type mRNA
Unitrap ID UNI3005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149363529..149363663 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es