Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST413096
Clone ID OST413096
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST413096
Sequence
ACTGAGCTGACCCTGGAGCAGCCGCAGGGGGATTCCATGATGACCTGTGAACAGGCCCAGCTTCTGGCCAACCTGGCGCG
GCTCATTAAGGCCAAGAAAGCTCTGGATCTGGGTACTTTCACGGGCTACTCGGCCCTGGCCCTAGCCTTGGCGCTTCCGG
AGGCTGGCCGCGTGGTGACCTGCGAGGTTGACGCAGAGCCCCCGAAGCTGGGACGGCCCATGTGGAAGCAGGCANAAGTG
GAGCAGAAGATCGACCTTCGGCTGCAGCCCGCCCTGCAGACATTGGATGAGCTCCTAGCTGGCGGGCGAGGCCGGAACCT
TCGACATAGCCGTGGTGGACGCGGACAAAGAGAACTGTACCGCCTACTACGAGCGCTGTCTGCAGCTCCTACGTCCCGGA
GGCGTGCTCGCTGTACTCAGAGTCCTGTGGCGCGGAGAAGTGCTGNAGNCTCAGCCCAGGAACAAGACTGTTGAATGTGT
GCGGAACCTGAACGAACGCATCCTGAGGGACGCCAGG
Sequence Type mRNA
Unitrap ID UNI18847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22666554..22667539 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021773 (Comtd1) NM_026965 catechol-O-methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Comtd1-001]

 
Come back to gene ENSMUSG00000021773


For any suggestions or comments, please send an email to unitrap@crg.es