Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST412998
Clone ID OST412998
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST412998
Sequence
TGAGGAATCTGGCCAACTGTGAGCGCCTCATTGAAGTGGAGGATATGATGGTGATGGGCCGCAAGCCGGACCCCATGTGT
GTCTTCACCTATGTGCAGTCGCTCTACAACCACCTTCGTCGCTTTGAGTAAAGCCGGCGGCCCGGAGTGGCCAGGAAGAG
ACTCTGAGGTCCCTCACGTTCCCCCCATGGCAGCATGATCCACACNGAGGGAAGCTGCCTCTCTGGTGTGAGCTGCTATT
CGCTCTCTGGCGTGTGACCATGTGCCCCTCACACTCGTTACTGATTAAAAGTATTGATGAGGCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72204615..72204917 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045667 (Smtnl2) NM_177776 smoothelin-like 2 Gene [Source:MGI (curated);Acc:Smtnl2-001]

 
Come back to gene ENSMUSG00000045667


For any suggestions or comments, please send an email to unitrap@crg.es