Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST412831
Clone ID OST412831
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST412831
Sequence
CAGCATCTGTTTACTAAAGACGTGACAGTGATTGAAGGAGAAGTGGCAACCATCAGCTGCCAGGTCAATAAGAGTGACGA
CTCAGTGATCCAGCTCCTGAACCCCAACAGGCAGACCATTTACTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTC
AGCTGCTGAATTTTTCTAGCAGTGAACTCAAAGTGTCACTGACGAATGTCTCAATCTCGGATGAAGGGAGATACTTCTGC
CAGCTCTACACGGACCCCCCACAGGAGAGTTACACCACCATCACAGTCCTGGTTCCTCCACGTAACTTGATGATCGATAT
CCAGAAAGACACGGNAGTNTGAAGGGGAGGAGATTGAAGTNAACTGTTCTGNCATGGCCAGCAAGCCCAGCGACGACCAT
CAGNGCGGTTCAAAGGGAACATGGC
Sequence Type mRNA
Unitrap ID UNI18862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47596062..47605618 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es