Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST412698
Clone ID OST412698
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST412698
Sequence
AGAGAGCCATTTCTGCTTTGGAGAAGGCAAGTTTAATGAAGAGAAAGAAAAACAGGAGCAGTTGCTACTGAGACTCCTCG
AATACCATCGGCTGCACCTTGCAAACACTCTCAAGTGGACATGAAGGAAGGGGTGGGGGGAGGG
Sequence Type mRNA
Unitrap ID UNI18870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98020515..98020658 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es