Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BB0525
Clone ID BB0525
Vector pGT2lxr
Project sanger

Sequence tag BB0525
Sequence
AACGGTCAGAGGGCGGAGTCTTTGGATGACCGGATTCTCTCCAGGCACACGTCCTGTACAGGCGACTTCGGGCCAGAGTA
TGAAAATGTCCGCCATTATGAGGAGATACCCGAGTATGAGAATTTGCCCTTTGTCATGGCTGGAAGGAACACTCCGGACT
TGGGATGGCAGAACTCCAGCAGTGTGGAGGACACTGATGCAAGCCTGTATGAAGTGGAAGAGCCCTACAATGCTCCAGAT
GGCCAGCTGCAACTTGATCCTAGACATCAGCCTTGCAG
Sequence Type mRNA
Unitrap ID UNI3598

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93508101..93508378 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020021 (Fgd6) NP_444302 FYVE, RhoGEF and PH domain containing 6 Gene [Source:MGI (curated);Acc:Fgd6-001]

 
Come back to gene ENSMUSG00000020021


For any suggestions or comments, please send an email to unitrap@crg.es