Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0561
Clone ID BA0561
Vector pGT2lxr
Project sanger

Sequence tag BA0561
Sequence
GACTGTGGGCAGCCAGGGGACGCCGCGCCTGCGCAATGGTTCTCCTCTGACTGCTGTGGCGTCGGTGTCCCAGAGCCCCG
GGGCTGGTGGTGGTCCACGGTGGCAGAGATGACCCAAGCCGAGAAGGGGTACGCGGAGAACGGGAAGGAGAAGGGCGGGG
AGAAGGAGAAGGAGCAGCGCGGCGTGAAGCGGCCCATCGTACCCGCGTTGGTCCCGGAGTCGCTGCAGGAGCAAATCCAG
AGCAAGTTCATTGTTGTCATACACCCAGGTTCAACAACTATAAGACTTGGCCGAGCCACAGATACACTTCCGGTCAGTGT
TCCTCACGTCATTGCATGAAGACACAAACAACAAGGGCAGCCCCTGTACAAGGACAACTGGCTCCTAAGGGAAGGACTAA
AT
Sequence Type mRNA
Unitrap ID UNI3607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30791544..30795955 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015971 (Actr8) NM_027493 ARP8 actin-related protein 8 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1860775]

 
Come back to gene ENSMUSG00000015971


For any suggestions or comments, please send an email to unitrap@crg.es