Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST411064
Clone ID OST411064
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST411064
Sequence
GAACTGAGGTGACCTTTGAAAGTTAACAGGGGTGCCATGGGCTGAGTAAGATAAACGGAACTGCTGTTCAACCCCGNNCA
GACTGNNGATGAGTCATTGTTTTCAAATTTATGAACAAAGCACACAAATTAAGAATAATACAAGCAAGAAACAGCAGAGA
GACACAAAAGGACATAGAATCCCTGATCCTCACTGTGATCTGGTAACACTAGTTCTAGGGCTGGAGAGAGAGATGCTCAG
GGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCTATTTCATACATGTG
GGGCAGAACACCGATACACATACTTTTTTTTTTAAGAATTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153168237..153168602 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073236 (2500004C02Rik) RIKEN cDNA 2500004C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919576]

 
Come back to gene ENSMUSG00000073236


For any suggestions or comments, please send an email to unitrap@crg.es