Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST410854
Clone ID OST410854
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST410854
Sequence
GGCTGTGCCTGGCTCTTCCTGAGAGNCATACGATGGTGCGTTGTGTCAGATCATGAGGCCACTAAGTGTTCTAGTTTCCG
TGACAATATGAAGAAAGTCCTTCCTGCAGGTGGCCCAGCTGTTACCTGTGTAAGGAAAATGTCTCACCCTGAGTGCATCC
AGGGACATCTCGGCCAATAAAGTAGATGCNTGTGACTGTTGACAGGAGCCTTTGGTGGCTGAAGCTGACCTGCCTCACCA
CAGCCTGAAACCTATCATGGCAGAATACTATGGATCAAAAGATGATCCAAAAACCCATTATTATGTTGTGGCCATGGCAA
AGAAGGGAACAGGCTTCCAACTGAACCAGCTCCGGGGCAAGAAGTCCTGCCATACTGGCCTGGGCTGGNCTGCTGGGCGG
TAACCCAGGGGCTGNGGACCCAACTGNTTGCCTCCATGCGGACCTTGTGCAGAATGANTAAAAGTATCTTCCCAGAAAAA
AAAAA
Sequence Type mRNA
Unitrap ID UNI18928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103152857..103184997 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033688 (1300017J02Rik) NM_027918 RIKEN cDNA 1300017J02 gene Gene [Source:MGI Symbol;Acc:MGI:1919025]

 
Come back to gene ENSMUSG00000033688


For any suggestions or comments, please send an email to unitrap@crg.es