Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST410733
Clone ID OST410733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST410733
Sequence
CCCTGCATCACCACATCTCTGTAGCGCAGGACCGATGAGCTCCTTCCTGCCAGGACCTCTCAGCGGGCTCCACACCCTCT
GGACTCCAAGACCACATCTGACGTTCTAAGGTTTGTGCTGGAGCAGTACAACGCCCTATCCTGGCTCACGGTGCAATCCA
GCCACCCAGGACCAGCACTTCCTGCCTTCCCGTCCACTTCGTGGTGCTCACGCAGCTGTACAATGCCATCATGAACATGC
TCTAACCGGGAAGGGAAGCGCTNGCCCTCTGCCTCAGCTCCTCCTGCAGCCTTGGCCAGGGAGCCTGCTCCACTCTGCAA
ATGCCCGGCCTTTTTTAGAGCACTCCCTATACCCCGCACTGTGACGCCTTCTGAGCAGGCTCATGCTCCTCCTGCAGTGN
TCATTGCCACAGTGACTTCTTGACGTGTCTCACGAGGACCTGGAAATTTCCATAAGCAGNGACTTGAGCCAANGTGCGAT
ATGTGCAGCCNGTAGTNCCCGGGAAGTGGCGGCTGTTGGTGGCTGAAGAGGCAT
Sequence Type mRNA
Unitrap ID UNI7258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 119211299..119213130 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018076 (Med13l) NP_766012 mediator complex subunit 13-like Gene [Source:MGI Symbol;Acc:MGI:2670178]

 
Come back to gene ENSMUSG00000018076


For any suggestions or comments, please send an email to unitrap@crg.es