Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST409544
Clone ID OST409544
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST409544
Sequence
GAGGCTGGTGGTAGCAGAGTCAACATCAAAGTATGCTTCGTGGTGTTCTGGGAAAGGCTTTTCGACTTGCTGGCTATACC
ATTCAGTATGGCTGCATAGCTCATTGTGCTTTTGAATACGTTGGTGGTGTTGTAATGTGTTCTGGACCATCAATGGAACC
CACAATTCAAAATTCAGATATTGTCTTTGCAGAAAATCTTAGCCGACATTTTTATGGCATCCAAAGAGGTGACATTGTAA
TTGCAAAAAGCCCAAGTGATCCAAAATCAAATATCTGTAAAAGAGTAATTGGTTTGGAAGGAGACAAAATCCTCAGCACT
AGTCCATCTGATGTATTTAAGAGCCGCAGTTACGTGCCAACAGGTCATGTTTGGTTAGAAGGTGATAACTTACAGAATTC
TACCGATTCCAGGTATTATGGACCTATACCATATGGACTAATAAGAGGACGTATCTTCTTTAAGATTTGGCCTTTCAGTG
ACTTCGGATTTCTGCGTGACAGCCCAAATGGCC
Sequence Type mRNA
Unitrap ID UNI18330

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 105770874..105805469 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042670 (Immp1l) NM_028260 IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Immp1l-001]

 
Come back to gene ENSMUSG00000042670


For any suggestions or comments, please send an email to unitrap@crg.es