Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST409046
Clone ID OST409046
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST409046
Sequence
GTGCACTCACACCCTCGCTTNTAGGTGGTGATGGGNGGAATGGTGNTGGAGACAAACATGAATGAANTTGGGGCTNAAAT
CGAAGCTCAAAACCGACTGGAGAAGTCGGAGGGCGGCCTCTCTGCAGCCTCCAGCAAGGGCCGTGTCCGCTGTGAAGAAC
ATCAACCTCCCTGAGATCCCCAGGAACATCAACATCGGTGACCTCAACATCAAAGTCCCCAACCTGTCCCAGTTTGTGTG
AAGGTGGGGGACTGGGCTGAACTGGAGNTCGCAGGATGAGCAAAGCAGTCAAGTCCAGAAGCAAAACCCCGTTGAGCCTT
TAGAGTCGNACCTTGGGGCCCTGCACCTTTCCCAGAGNGGGAATGGAGTTGGGCGCACACTTCNTGGCCATCCTGGTGCT
CCTGACTCACGG
Sequence Type mRNA
Unitrap ID UNI18950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87025199..87027459 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063801 (Ap3s2) NM_009682 adaptor-related protein complex 3, sigma 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1337060]

 
Come back to gene ENSMUSG00000063801


For any suggestions or comments, please send an email to unitrap@crg.es