Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST408563
Clone ID OST408563
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST408563
Sequence
TTGGATGTTAAAGCTGACGTTTAGCTGTGAGCAGCGTTTCCTGCGCAAGTCAGAGCTGGACAGGGAGGCTGAGGAGCACT
GCAGGCAGCTCACAGAGTGTGACCGACTTTGAGTACACCNGTGGACAGCTTGGGCTCCATCTCGAAGGCCAAAGAGAGGA
CCACAGATTTTGTCAAGAAGACAAGCAGGCCAAAGAATAAGAAGNGGATGGANCACCTGNAGGTGCNGAAAAGAGCCCTG
NACAGGCGGCTGGTCGGCA
Sequence Type mRNA
Unitrap ID UNI18966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119021187..119021608 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038060 (Dlec1) deleted in lung and esophageal cancer 1 Gene [Source:MGI Symbol;Acc:MGI:2443671]

 
Come back to gene ENSMUSG00000038060


For any suggestions or comments, please send an email to unitrap@crg.es