Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST408462
Clone ID OST408462
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST408462
Sequence
TGCCCAGCCCCTTTGCTGATGAATCCAGCTGCCAGTGCCAAGCACCTCATGAAAAACTGACCGNNGCCCAGGCCCGCTTA
GGAACACCAGTTGATAGGCCTGTTAGAGTGTATGCAGATGGAATATTTGACCTCTTCCACTCAGGTCACGCAAGGGCACT
TATGCAAGCAAAAACACTGTTTCCCAACAGCTACTTGTTGGTAGGAG
Sequence Type mRNA
Unitrap ID UNI17430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90947436..90952013 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es