Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST408275
Clone ID OST408275
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST408275
Sequence
TGAGATAAGCAAGTAGCTGTTGCATTGGTGCGGGCTATGTCGGCGGACCCACGTGCAGTGTCATTGCTCACATGTGCCCT
GAAATCAGGGTTACTGGTTGTGGATGTCAACCGAGGCAAGGATCAATGCATGGAATTCTCCAACCCTTCCTATTTATGAG
CCTGGATTAAAAGAAGTAGTCGAATCCTGTCGAGGAAAAAACCTATTTTTTTCTACCAATATTGATGATGCCATCAGAGA
AGCCGATCTAGTATTTATTTCTGTGAACACACCAACAAAAACATANGGGATGGGAAAAGGCCGGNCAGCANACCTGAAGN
ATNTCGAAGCCTTGTGCTCGCCGCATTGGGCNNAACTCNAATGGGTACAAAATTGNCACGNNNAAAAGCACAGTCCCCTG
TGCCGGTCNGCATGAAAGCATNCCGCCGNATATTTGTTGCCAACACA
Sequence Type mRNA
Unitrap ID UNI18977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65814710..65818811 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029201 (Ugdh) NM_009466 UDP-glucose dehydrogenase Gene [Source:MGI (curated);Acc:Ugdh-001]

 
Come back to gene ENSMUSG00000029201


For any suggestions or comments, please send an email to unitrap@crg.es