Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST407758
Clone ID OST407758
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST407758
Sequence
AGACCATTCTCAACGCATTCAAGGTGTTTGATCCCGAGGGCAAAGGGTCACTGAAGGCTGACTATGTCCGGGAGATGCTG
ACCACACAAGCAGAGAGGTTCTCCAAAGAGGAGATCGACCAGATGTTCGCAGCCTTTCCCCCTGACGTCACCGGCAANCT
TGATTATAAGAATTTGGTCCACATCATTACCCACGGAGAAGAGAAGGACTGAGCCCTGAACCACAGCCTCAGGTGACCCA
CAGCCCACTCTCCATCCCAGGGCTGTGCGCAAATAAACAGGAAGTCTTGGCTCTGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18982

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122554851..122556861 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013936 (Myl2) NM_010861 myosin, light polypeptide 2, regulatory, cardiac, slow Gene [Source:MGI (curated);Acc:Myl2-012]

 
Come back to gene ENSMUSG00000013936


For any suggestions or comments, please send an email to unitrap@crg.es