Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST407572
Clone ID OST407572
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST407572
Sequence
TTCCCTGAGAGCAGTGCTGACTTTCGCGCGATGTCTGATCCGGAGAAAAATTGTCACACTGGACAGCCTTGAAGATTCCA
AACTCTGCCGCTGCTTAACCACCGTGGACCTCATCGCTTTGGGGGTTGGAAGCACTCTGGGCGCTGGGGTCTACGTCCTG
GCTGGGGAAGTCGCCAAAGCCGATTCTGGCCCGAGTATCGTGGTGTCTTTCCTCATCGCTGCCCTGGCCTCGGTTATGGC
CGGCCTTTGCTATGCTGAATTTGGGGCCCGAGTACCCAAGACTGGATCTGCGTATCTATACACTTACGTCACGGTCGGAG
AGCTGTGGGCCTTCATCACTGGCTGGAATCTCATCCTGTCATATGTCATAGGTACGTCCAGNGTCGCAAGAGCATGGAGT
GGCACCTTTGACGAACTTCTTAATAAACAGATTGGCCAGTTTTTCAAAACA
Sequence Type mRNA
Unitrap ID UNI18992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41984311..41985488 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031596 (Slc7a2) NM_007514 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 Gene [Source:MGI (curated);Acc:Slc7a2-003]

 
Come back to gene ENSMUSG00000031596


For any suggestions or comments, please send an email to unitrap@crg.es