Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0140
Clone ID BC0140
Vector pGT2lxr
Project sanger

Sequence tag BC0140
Sequence
TTTACCCAGAGGCTTTGGAGTTCAAGAACTGGAAATACAGCAGTCGGGTTTACTGTTTGAACAGAGCCGCTGTGCGGTGC
ACAGGAAAAGAGGTGACAGTCCAGGCCGACTCGTCCCCTGTGGGGCAGCTATCAGCTGGAGCGCTGTCCCTCAGCAGTGG
TTGTAGCTATACCAGATGGTTTTCCACAGGGAACAACAAAGAAAGAGATGGAAGCCCTAGGGCCAG
Sequence Type mRNA
Unitrap ID UNI3626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114501939..114503326 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031949 (Adat1) NM_013925 adenosine deaminase, tRNA-specific 1 Gene [Source:MGI (curated);Acc:Adat1-002]

 
Come back to gene ENSMUSG00000031949


For any suggestions or comments, please send an email to unitrap@crg.es