Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST406652
Clone ID OST406652
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST406652
Sequence
TGGTGCTGTAGACCAACGAAGTAACCTCTTCCTAAAAAGGTCCGACTGAGTGAAACAGACTTCAAAGTTATGGCACGGGA
TGAGTTAATTCTAAGATGGAAACAATATGAAGCATATGTTCAAGCTTTGGAGGGAAAGTACACAGATCTTAATTCAAACG
ATGTGACTGGNTTAAGGGAATCTGAAGANANACTAAAGCAGCANCAGCAGGAGTCTGCACGCAGGGAGAACATTCTTGTC
ATGCGGCTAGCAACCANAGAGCAGGAGATGCAAGAGTGCACCACTCAAATCCAGTACCTCAAGCAAGNTCAGCNGCCNAG
TGTGGCCCAACTGAGATCAACAATGG
Sequence Type mRNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13168277..13178809 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es