Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0124
Clone ID BC0124
Vector pGT2lxr
Project sanger

Sequence tag BC0124
Sequence
GGGGGTTTTTTAGGAGGGTTTTTTTTTTGTGTCTTAGTCGCCCATATACTAACAAGGTCATTACTTTGTGGTATCGTCCA
CTTGAATTGCTCTTGGGAGAAGAACGATATACACCAGCCATTGATGTATGGAGCTGTGGATGTATCCTTGGTGAACTCTT
CACTAAAAAACTTATATTTCAAGCAAACCAGGAACTTGCACAGCTAGAGCTAATAA
Sequence Type mRNA
Unitrap ID UNI3628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17830752..18089780 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041297 (Cdc2l5) NM_001081058 cell division cycle 2-like 5 (cholinesterase-related cell division controller) Gene [Source:MGI Symbol;Acc:MGI:1916812]

 
Come back to gene ENSMUSG00000041297


For any suggestions or comments, please send an email to unitrap@crg.es