Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST406382
Clone ID OST406382
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST406382
Sequence
CCCTGAGAATGGAGAGAGGAGCCANGGAGAGGAACCACCAGCTGTACAAGCCCTACACCAACGGAATCATTGCAAAAGAT
CCCACTTCTCTGGAAGAANTAATCAAAGAAATTCGTCGAAGNGGTAGTAGTAAAGCTCTGGATAAGACACCCGAGTTCGA
GCTCTCTGACATCTTCTACTTTTGCCGNAAAGGAATGGAGACTATCATGGATGATGAAGNGACAAAGAGATTCTCGGCAG
AGGAGCTGG
Sequence Type mRNA
Unitrap ID UNI10190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24293250..24295063 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031545 (Agpat6) NM_018743 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) Gene [Source:MGI Symbol;Acc:MGI:2142716]

 
Come back to gene ENSMUSG00000031545


For any suggestions or comments, please send an email to unitrap@crg.es