Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST405807
Clone ID OST405807
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST405807
Sequence
GAGTTGCTGATCATCTGGGCTGTGATCCTCAAACACGGTTCTTTGTCCCTCCTAATATCAAACAGTGGATCGCCTTGCTA
CAAAGAGGAAATTGCACCTTTAAAGAGAAAATATCACGGGCTGCTTTTCACAATGCGGTTGCTGTAGTCATCTACAATAA
TAAATCCAAAGAGGAGCCGGTCACCATGACTCATCCAGGCACGGNCTGATATTATTGCTGTCATGATAACAGAATTGNGG
GGTAAGGATATTTTGAGTTATCTGGAGAAAAACATCTCTGTACAAATGACAATAGCTGTTGGAACTCGAATGCCGCCAAA
GAACTTCAGCCGTGGCTCTCTAGTCTTCGTGTCAATCTCCTTTATTGNNTTGANGATTATNTCTTNAGCGNGGCTCATAT
TCTACTTCNTTCANAANATCAGGTACACANCNTGCTCGNGNCAGGAACCAGGTGAGCTAACCAGNACTCTANCCANCGCG
TANNCCATGAGGATCTTGCGATAATACTTGCTTATGTCA
Sequence Type mRNA
Unitrap ID UNI17487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 49866276..49884990 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020376 (Rnf130) NM_021540 ring finger protein 130 Gene [Source:MGI (curated);Acc:Rnf130-002]

 
Come back to gene ENSMUSG00000020376


For any suggestions or comments, please send an email to unitrap@crg.es