Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST405771
Clone ID OST405771
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST405771
Sequence
ACTGAGTAATAGTTATGCACGAGTGCGAGCTGTGGTGATGACCAGAGATGACTCAAGTGGTGGATGGCTACCACTCGGAG
GGAGCGGACTGAGCAGCGTCACTGTCTTCAGAGTCCCTCATCAGGAAGAGAATGGCTGTGCGGACTTTTTTATCCGTGGA
GAGAGACTCAGAGACAAAATGGTAATGTTTAATATAGCCTGTCACTGTAATTTTATGGTACTTTCTGAAAAAATGAATTA
TCTGTTTAAAATTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 116978726..116978974 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027351 (Spred1) NM_033524 sprouty protein with EVH-1 domain 1, related sequence Gene [Source:MGI (curated);Acc:Spred1-001]

 
Come back to gene ENSMUSG00000027351


For any suggestions or comments, please send an email to unitrap@crg.es