Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST405401
Clone ID OST405401
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST405401
Sequence
TGGCATGTGGTTGAAGGCCTAGAACCAAGGACACTATACAAATTTCGACTGAAGGTCACCAGCCCCTCTGGAGAATATGA
GTACAGCCCAGTCGTCTCGGTGGCTACGACCCGGGAGCCCATAAGTAGCGAACACTTTCATCGTGCTGTCAGTGTGAACG
ATGAAGATCTCCTGCTTCTAATTTTGGAAGGAGGCCATGTCATGATTGACGTGCCCAACAAATTTGGCTTTTACCGCTCT
CATGGTTGCTGCTCAGAAAGGNTACACCAGGCTTGTGAAGATCCTAGTTTCCAATGGCACAGATGTGAATC
Sequence Type mRNA
Unitrap ID UNI19075

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 141053800..141061745 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053111 (Fank1) NM_025850 fibronectin type 3 and ankyrin repeat domains 1 Gene [Source:MGI (curated);Acc:Fank1-001]

 
Come back to gene ENSMUSG00000053111


For any suggestions or comments, please send an email to unitrap@crg.es