Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST405341
Clone ID OST405341
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST405341
Sequence
GTGGGGTCTTTCACCACGTCGTGTTCTTGCGGCTCCGCGAGGGCGTAAGAAACCAGAGTCCAGCCGAAGCGGAGAAGCCA
GCGGCTTCGACTTCACCCTCGTGCCCGTCTCTGCCGCCGCATTTGCCGACGAGAAACCTGGTCTTCGGCCTCGGAGGGGA
ACTTGTTTCTGTGGGACGCAGAAGGCAGCGCCTTCTTGGTGGTTCGCCTTCGAGGCCCCAGCGGTGGTGGCGTGGAGCCC
CCTCTCTCCCAGTATCA
Sequence Type mRNA
Unitrap ID UNI19080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70783152..70783395 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040667 (Nup88) NM_001083331 nucleoporin 88 Gene [Source:MGI (curated);Acc:Nup88-001]

 
Come back to gene ENSMUSG00000040667


For any suggestions or comments, please send an email to unitrap@crg.es