Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST405139
Clone ID OST405139
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST405139
Sequence
GATCTGAGTGCACGTCCTGGTCGATCAAGGAGACAGTGGGGCATCTTGCAGGGCTGGCGGATGGTCAGCTTGATTTGGAG
ACGTTTGTGATGGGGTATGAAGAAGAGGGCAGTGAGAGATTGAGAGGGAAAACAGAAAGTGAGGTGAGTGGTGGACAGGA
GGCATGATTACGAGGCCTGGGCCTGGAAGGAGGAAGACAGGAAGAGAGAAGGGTGGACAGCTGTGNNGAAGGCCGACACC
TGGNCTGCCCTCGAGCCCCAAGGCCAGGGAGGACAGGACTGCTCCCTGGGAAGAACTGGNTCTCAGNGTTCCCCAGGCAC
TGGCCAAACTGGCTGTGCTAGC
Sequence Type mRNA
Unitrap ID UNI19086

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119095094..119095412 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034226 (Rhov) NM_145530 ras homolog gene family, member V Gene [Source:MGI (curated);Acc:Rhov-001]

 
Come back to gene ENSMUSG00000034226


For any suggestions or comments, please send an email to unitrap@crg.es